| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-04-06 06:33:10 |
| Analysis completed | 2025-04-06 06:33:10 |
| Wall time | 0:0:0 hours |
| locus | rbcL |
| preliminary_id | Planta |
| taxa_of_interest |
Nicotiana tabacum |
| country | Indonesia |
| host | NA |
| sample_id | MP23-0431_rbcL |
| Query DNA sequence |
>MP23-0431_rbcL GTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAGTACC AAACCAAGGATACTGATATATTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCAC CTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTAT GGACCGATGGACTTACCAGYCTTGATCGTTACAAAGGACGATGCTACCGCATCGAGCGTG TTGTTGGAGAAAAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAG AAGGTTCTGTTACCAACATGTTTACTTCCATTGTAGGTAACGTATTTGGGTTCAAAGCCC TGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCTCCTGCTTATGTTAAAACTTTCCAAG GTCCGCCTCATGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGT TGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCTGTTT ATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCACAAC CATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGG CTGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAA TGATCAAAAGAGCTGTATTTGCTAGAGAATTGGGCGTTCCGATCGTAATGCATGACTACT TAACGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACT TCTTCACATCCACCGTGCAATGCATGCGGTTATTGATAGACAGAAGAATCATGGTATCCA CTTCCGGGTATTAGCAAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACTCT
Inconclusive
The analyst should attempt subjective species identification at the genus level.
Reasoning - Flag 1C:
>3 candidate species matched with high stringency (identity ≥ 98.5%).
| Preliminary morphology ID confirmed | NA |
|
Inconclusive taxonomic identity (Flag 1C) |
|
| Taxa of interest ruled out | False |
|
Flag 2B: Taxon of interest detected Flag 5.1A: The given locus for this taxon is well represented in reference database (>5 entries) Flag 5.2B: 10-90% of related taxa have reference sequence(s) at the given locus |
|
Flag 1C:
The analyst should attempt subjective species identification at the genus level
>3 candidate species matched with high stringency (identity ≥ 98.5%)
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits are then classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 499 | 201 |
| MODERATE MATCH | ≥ 93.5% | NA | NA |
| NO MATCH | < 93.5% |
Hits per candidate species (top 10 candidates only)
| Species | Hits | Identity | E-value |
|---|---|---|---|
| Nicotiana sylvestris | 2 | 99.7% | 0.0 |
| Nicotiana knightiana | 1 | 99.7% | 0.0 |
| Nicotiana tabacum | 13 | 99.7% | 0.0 |
| Nicotiana paniculata | 1 | 99.7% | 0.0 |
| Nicotiana rustica | 1 | 99.7% | 0.0 |
| Nicotiana glauca | 2 | 99.6% | 0.0 |
| Nicotiana attenuata | 3 | 99.6% | 0.0 |
| Nicotiana suaveolens | 1 | 99.5% | 0.0 |
| Nicotiana amplexicaulis | 1 | 99.5% | 0.0 |
| Nicotiana benthamiana | 1 | 99.5% | 0.0 |
| # | Accession | Hit subject | Align length | Query coverage | Score | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | KM025249 | Nicotiana sylvestris ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 955 | 100.0% | 947.0 | 0.00e+00 | 99.7% |
| 2 | BK010737 | TPA_asm: Nicotiana knightiana chloroplast, complete genome | 955 | 100.0% | 947.0 | 0.00e+00 | 99.7% |
| 3 | AP019624 | Nicotiana tabacum apxA_T2_120719 chloroplast DNA, complete genome | 955 | 100.0% | 947.0 | 0.00e+00 | 99.7% |
| 4 | OQ473890 | Nicotiana tabacum isolate PilotoCubano chloroplast, complete genome | 955 | 100.0% | 947.0 | 0.00e+00 | 99.7% |
| 5 | AP019623 | Nicotiana tabacum SR1_120719 chloroplast DNA, complete genome | 955 | 100.0% | 947.0 | 0.00e+00 | 99.7% |
| 6 | MZ707522 | Nicotiana tabacum chloroplast, complete genome | 955 | 100.0% | 947.0 | 0.00e+00 | 99.7% |
| 7 | KU199713 | Nicotiana tabacum cultivar TN90 plastid, complete genome | 955 | 100.0% | 947.0 | 0.00e+00 | 99.7% |
| 8 | NC_007500 | Nicotiana sylvestris chloroplast, complete genome | 955 | 100.0% | 947.0 | 0.00e+00 | 99.7% |
| 9 | NC_001879 | Nicotiana tabacum plastid, complete genome | 955 | 100.0% | 947.0 | 0.00e+00 | 99.7% |
| 10 | OQ473888 | Nicotiana tabacum isolate Hainan2 chloroplast, complete genome | 955 | 100.0% | 947.0 | 0.00e+00 | 99.7% |
| 11 | OQ473889 | Nicotiana tabacum isolate Hainan3 chloroplast, complete genome | 955 | 100.0% | 947.0 | 0.00e+00 | 99.7% |
| 12 | AP019625 | Nicotiana tabacum apxC_T2_120719 chloroplast DNA, large circle chloroplast, complete genome | 955 | 100.0% | 947.0 | 0.00e+00 | 99.7% |
| 13 | BK010741 | TPA_asm: Nicotiana paniculata chloroplast, complete genome | 955 | 100.0% | 947.0 | 0.00e+00 | 99.7% |
| 14 | OQ473886 | Nicotiana tabacum isolate 7-CX14 chloroplast, complete genome | 955 | 100.0% | 947.0 | 0.00e+00 | 99.7% |
| 15 | OQ473887 | Nicotiana tabacum isolate 189802E-Habana2000 chloroplast, complete genome | 955 | 100.0% | 947.0 | 0.00e+00 | 99.7% |
| 16 | BK010738 | TPA_asm: Nicotiana rustica chloroplast, complete genome | 955 | 100.0% | 947.0 | 0.00e+00 | 99.7% |
| 17 | NC_056979 | Nicotiana glauca chloroplast, complete genome | 955 | 100.0% | 944.0 | 0.00e+00 | 99.6% |
| 18 | MG182422 | Nicotiana attenuata chloroplast, complete genome | 955 | 100.0% | 944.0 | 0.00e+00 | 99.6% |
| 19 | JF419563 | Nicotiana attenuata ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) mRNA, complete cds; chloroplast | 955 | 100.0% | 944.0 | 0.00e+00 | 99.6% |
| 20 | NC_035952 | Nicotiana attenuata chloroplast, complete genome | 955 | 100.0% | 944.0 | 0.00e+00 | 99.6% |
| 21 | BK010740 | TPA_asm: Nicotiana glauca chloroplast, complete genome | 955 | 100.0% | 944.0 | 0.00e+00 | 99.6% |
| 22 | NC_056978 | Nicotiana suaveolens chloroplast, complete genome | 955 | 100.0% | 941.0 | 0.00e+00 | 99.5% |
| 23 | NC_056976 | Nicotiana amplexicaulis chloroplast, complete genome | 955 | 100.0% | 941.0 | 0.00e+00 | 99.5% |
| 24 | LT576836 | Nicotiana tabacum chloroplast rbcL gene for Rubisco large subunit, cultivar Petit-Havana | 955 | 100.0% | 941.0 | 0.00e+00 | 99.5% |
| 25 | LC617401 | Nicotiana benthamiana NbWT_20_0_01 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase, complete cds | 955 | 100.0% | 941.0 | 0.00e+00 | 99.5% |
| 26 | U08608 | Anthocercis viscosa chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds | 955 | 100.0% | 941.0 | 0.00e+00 | 99.5% |
| 27 | J01450 | Nicotiana tabacum coupling factor beta-subunit gene, partial cds; and ribulose-1,5-biphosphate carboxylase/ oxygenase large subunit gene, complete cds; chloroplast genes for chloroplast products | 955 | 100.0% | 941.0 | 0.00e+00 | 99.5% |
| 28 | NC_056977 | Nicotiana debneyi chloroplast, complete genome | 955 | 100.0% | 941.0 | 0.00e+00 | 99.5% |
| 29 | MT596796 | Plastid transformation vector pLEV IR-coS, complete sequence | 953 | 99.8% | 939.0 | 0.00e+00 | 99.5% |
| 30 | D70815 | Nicotiana debneyi chloroplast rbcL gene for ribulose -1,5-bisphosphate carboxylase/oxygenase large subunit, complete cds | 955 | 100.0% | 938.0 | 0.00e+00 | 99.4% |
| 31 | NC_029746 | Iochroma cardenasianum chloroplast, complete genome | 955 | 100.0% | 938.0 | 0.00e+00 | 99.4% |
| 32 | M16896 | Tobacco (N.acuminata) ribulose 1,5-bisphosphate carboxylase large subunit (rbcL) gene, complete cds | 955 | 100.0% | 938.0 | 0.00e+00 | 99.4% |
| 33 | KM360660 | Atropa belladonna ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid | 955 | 100.0% | 938.0 | 0.00e+00 | 99.4% |
| 34 | NC_004561 | Atropa belladonna chloroplast, complete genome | 955 | 100.0% | 938.0 | 0.00e+00 | 99.4% |
| 35 | AY558863 | Cuscuta compacta ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 955 | 100.0% | 938.0 | 0.00e+00 | 99.4% |
| 36 | PV078024 | Mandragora officinarum voucher personal collection:JeremyBechelli:04-SSU chloroplast, complete genome | 955 | 100.0% | 938.0 | 0.00e+00 | 99.4% |
| 37 | U08609 | Atropa belladonna chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds | 955 | 100.0% | 938.0 | 0.00e+00 | 99.4% |
| 38 | PV078023 | Mandragora turcomanica voucher personal collection:JeremyBechelli:06-SSU chloroplast, complete genome | 955 | 100.0% | 938.0 | 0.00e+00 | 99.4% |
| 39 | LC649170 | Nicotiana plumbaginifolia YN25 chloroplast, complete genome | 955 | 100.0% | 938.0 | 0.00e+00 | 99.4% |
| 40 | BK010739 | TPA_asm: Nicotiana obtusifolia chloroplast, complete genome | 952 | 99.7% | 935.0 | 0.00e+00 | 99.4% |
| 41 | MN218090 | Solanum sisymbriifolium isolate NN15 chloroplast, complete genome | 955 | 100.0% | 935.0 | 0.00e+00 | 99.3% |
| 42 | JN563930 | Synthetic construct Nicotiana undulata chloroplast clone pCK2-6, complete sequence | 955 | 100.0% | 935.0 | 0.00e+00 | 99.3% |
| 43 | MZ221862 | Solanum sisymbriifolium voucher E:Sarkinen et al. 4536 chloroplast, complete genome | 955 | 100.0% | 935.0 | 0.00e+00 | 99.3% |
| 44 | NC_030282 | Scopolia parviflora chloroplast, complete genome | 955 | 100.0% | 935.0 | 0.00e+00 | 99.3% |
| 45 | NC_062492 | Lycianthes radiata voucher E:Gonzales 2039 chloroplast, complete genome | 955 | 100.0% | 935.0 | 0.00e+00 | 99.3% |
| 46 | U08614 | Mandragora officinalis chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds | 955 | 100.0% | 935.0 | 0.00e+00 | 99.3% |
| 47 | NC_016068 | Nicotiana undulata chloroplast, complete genome | 955 | 100.0% | 935.0 | 0.00e+00 | 99.3% |
| 48 | XM_033661133 | PREDICTED: Nicotiana tomentosiformis ribulose bisphosphate carboxylase large chain (LOC117281257), mRNA | 955 | 100.0% | 935.0 | 0.00e+00 | 99.3% |
| 49 | MW470952 | Anisodus luridus chloroplast, complete genome | 955 | 100.0% | 935.0 | 0.00e+00 | 99.3% |
| 50 | PV078025 | Mandragora autumnalis voucher personal collection:JeremyBechelli:03-SSU chloroplast, complete genome | 955 | 100.0% | 935.0 | 0.00e+00 | 99.3% |
| 51 | NC_007602 | Nicotiana tomentosiformis chloroplast, complete genome | 955 | 100.0% | 935.0 | 0.00e+00 | 99.3% |
| 52 | MH360735 | Hyoscyamus niger ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 955 | 100.0% | 935.0 | 0.00e+00 | 99.3% |
| 53 | NC_061213 | Solanum sisymbriifolium chloroplast, complete genome | 955 | 100.0% | 935.0 | 0.00e+00 | 99.3% |
| 54 | NC_024261 | Hyoscyamus niger chloroplast, complete genome | 955 | 100.0% | 935.0 | 0.00e+00 | 99.3% |
| 55 | MN262642 | Physochlaina physaloides chloroplast, complete genome | 954 | 99.9% | 934.0 | 0.00e+00 | 99.3% |
| 56 | NC_044154 | Physochlaina orientalis chloroplast, complete genome | 954 | 99.9% | 934.0 | 0.00e+00 | 99.3% |
| 57 | U08620 | Solandra grandiflora chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds | 952 | 99.7% | 932.0 | 0.00e+00 | 99.3% |
| 58 | NC_041604 | Solanum etuberosum voucher PI 498311 plastid, complete genome | 955 | 100.0% | 932.0 | 0.00e+00 | 99.2% |
| 59 | NC_063110 | Scopolia carniolica chloroplast, complete genome | 955 | 100.0% | 932.0 | 0.00e+00 | 99.2% |
| 60 | KM025251 | Nicotiana tomentosiformis ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 955 | 100.0% | 932.0 | 0.00e+00 | 99.2% |
| 61 | U08611 | Datura stramonium chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds | 955 | 100.0% | 932.0 | 0.00e+00 | 99.2% |
| 62 | MW324578 | Przewalskia tangutica chloroplast, complete genome | 955 | 100.0% | 932.0 | 0.00e+00 | 99.2% |
| 63 | MN165114 | Nicandra physalodes chloroplast, complete genome | 955 | 100.0% | 932.0 | 0.00e+00 | 99.2% |
| 64 | MZ221881 | Solanum etuberosum voucher E:Gardner et al. 111 chloroplast, complete genome | 955 | 100.0% | 932.0 | 0.00e+00 | 99.2% |
| 65 | MW042817 | Solanaceae sp. YYL-2022 cultivar Henan chloroplast, complete genome | 955 | 100.0% | 932.0 | 0.00e+00 | 99.2% |
| 66 | PP234564 | Przewalskia tangutica isolate p53 chloroplast, complete genome | 955 | 100.0% | 932.0 | 0.00e+00 | 99.2% |
| 67 | MZ450974 | Hyoscyamus muticus chloroplast, complete genome | 955 | 100.0% | 932.0 | 0.00e+00 | 99.2% |
| 68 | NC_036733 | Przewalskia tangutica chloroplast, complete genome | 955 | 100.0% | 932.0 | 0.00e+00 | 99.2% |
| 69 | NC_041622 | Solanum palustre voucher PI 245763 plastid, complete genome | 955 | 100.0% | 932.0 | 0.00e+00 | 99.2% |
| 70 | U08615 | Nicandra physalodes chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds | 955 | 100.0% | 932.0 | 0.00e+00 | 99.2% |
| 71 | ON509842 | Solanum etuberosum voucher PI 558288 chloroplast, complete genome | 955 | 100.0% | 932.0 | 0.00e+00 | 99.2% |
| 72 | OM638061 | Solanum etuberosum chloroplast, complete genome | 955 | 100.0% | 932.0 | 0.00e+00 | 99.2% |
| 73 | NC_062874 | Solanum anomalostemon voucher BM:Knapp 10364 chloroplast, complete genome | 955 | 100.0% | 932.0 | 0.00e+00 | 99.2% |
| 74 | NC_086882 | Mandragora caulescens chloroplast, complete genome | 955 | 100.0% | 932.0 | 0.00e+00 | 99.2% |
| 75 | MT610897 | Datura stramonium chloroplast, complete genome | 955 | 100.0% | 929.0 | 0.00e+00 | 99.1% |
| 76 | NC_056981 | Nicotiana repanda chloroplast, complete genome | 955 | 100.0% | 929.0 | 0.00e+00 | 99.1% |
| 77 | KT178123 | Solanum rostratum voucher Aust 178 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; plastid | 955 | 100.0% | 929.0 | 0.00e+00 | 99.1% |
| 78 | NC_018117 | Datura stramonium chloroplast, complete genome | 955 | 100.0% | 929.0 | 0.00e+00 | 99.1% |
| 79 | MK347419 | Anisodus tanguticus chloroplast, complete genome | 955 | 100.0% | 929.0 | 0.00e+00 | 99.1% |
| 80 | MK244356 | Datura stramonium voucher QRI 540 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 955 | 100.0% | 929.0 | 0.00e+00 | 99.1% |
| 81 | OK040953 | Datura metel chloroplast, complete genome | 955 | 100.0% | 929.0 | 0.00e+00 | 99.1% |
| 82 | NC_057245 | Solanum rostratum chloroplast, complete genome | 955 | 100.0% | 929.0 | 0.00e+00 | 99.1% |
| 83 | NC_056980 | Nicotiana stocktonii chloroplast, complete genome | 955 | 100.0% | 929.0 | 0.00e+00 | 99.1% |
| 84 | MT610896 | Datura stramonium chloroplast, complete genome | 955 | 100.0% | 929.0 | 0.00e+00 | 99.1% |
| 85 | OM616889 | Datura stramonium isolate MSH-DS19 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 955 | 100.0% | 929.0 | 0.00e+00 | 99.1% |
| 86 | JN662489 | Datura stramonium isolate NN003 chloroplast, complete genome | 955 | 100.0% | 929.0 | 0.00e+00 | 99.1% |
| 87 | MH021551 | Solanum sogarandinum plastid, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 88 | NC_029833 | Iochroma australe chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 89 | KX086685 | Solanum pennellii isolate TGRC LA1272 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 90 | NC_030177 | Iochroma ellipticum chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 91 | MN990084 | Solanum pennellii chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 92 | OR400641 | Eriolarynx lorentzii chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 93 | OR426647 | Withania sp. chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 94 | KU310654 | Iochroma lehmannii plastid, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 95 | NC_026880 | Solanum neorickii isolate TS-146 chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 96 | MG946933 | Withania adpressa ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit gene, partial cds; chloroplast | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 97 | NC_030044 | Iochroma umbellatum chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 98 | NC_062081 | Solanum huaylasense chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 99 | NC_026694 | Saracha punctata chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 100 | NC_062080 | Solanum corneliomuelleri chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 101 | NC_026881 | Solanum peruvianum isolate TS-404 chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 102 | NC_026877 | Solanum chilense isolate TS-408 chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 103 | KT178124 | Solanum triflorum voucher Aust 161 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; plastid | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 104 | LC487531 | Datura metel chloroplast rbcL gene, ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial sequence | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 105 | BK010849 | TPA_asm: Withania riebeckii chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 106 | NC_069556 | Datura metel chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 107 | MT811797 | Solanum neorickii chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 108 | MG946934 | Withania coagulans ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit gene, partial cds; chloroplast | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 109 | NC_030178 | Iochroma cyaneum voucher Smith 265 chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 110 | NC_027177 | Iochroma tingoanum chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 111 | NC_030056 | Acnistus arborescens x Iochroma cyaneum chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 112 | NC_026567 | Iochroma nitidum chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 113 | U08616 | Nolana spathulata chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 114 | NC_030167 | Iochroma lehmannii chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 115 | NC_035742 | Solanum pennellii chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 116 | NC_030171 | Eriolarynx fasciculata chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 117 | M16867 | Tobacco (N.otophora) ribulose 1,5-bisphosphate carboxylase large subunit (rbcL) gene, complete cds | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 118 | KX086691 | Solanum lycopersicoides isolate TGRC LA2951 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 119 | BK010847 | TPA_asm: Withania adpressa chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 120 | MG946935 | Withania coagulans ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit gene, partial cds; chloroplast | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 121 | NC_027099 | Dunalia solanacea chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 122 | KX086696 | Solanum arcanum isolate TGRC LA2153 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 123 | NC_030168 | Iochroma salpoanum chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 124 | HG975452 | Solanum pennellii chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 125 | NC_066481 | Anisodus acutangulus chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 126 | NC_062867 | Solanum aligerum voucher BM:Knapp et al. 10436 chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 127 | NC_026563 | Dunalia obovata chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 128 | OQ473544 | Solanum chilense chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 129 | NC_062079 | Solanum chmielewskii chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 130 | NC_086523 | Solanum anamatophilum voucher CIP 761555 chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 131 | NC_026574 | Iochroma stenanthum chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 132 | OQ473540 | Solanum habrochaites chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 133 | NC_044471 | Atropanthe sinensis chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 134 | KX086690 | Solanum sitiens isolate TGRC LA4115 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 135 | NC_062486 | Solanum nitidum voucher E:Sarkinen et al. 4851 chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 136 | NC_026726 | Iochroma loxense chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 137 | NC_062078 | Solanum arcanum chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 138 | NC_030185 | Acnistus arborescens chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 139 | MN781973 | Anisodus acutangulus chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 140 | OR360843 | Trozelia umbellata chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 141 | OR400640 | Discopodium penninervium chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 142 | NC_047176 | Withania coagulans chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 143 | MK142783 | Withania somnifera chloroplast clone 154386, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 144 | KU306396 | Iochroma cyaneum chloroplast, complete genome | 955 | 100.0% | 926.0 | 0.00e+00 | 99.0% |
| 145 | AB051021 | Nolana albescens chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase, partial cds | 953 | 99.8% | 924.0 | 0.00e+00 | 99.0% |
| 146 | AB051025 | Lycium pallidum chloroplast rbcL gene for ribulose-1,5-bisphosphate cerboxylase/oxygenase, partial cds | 953 | 99.8% | 924.0 | 0.00e+00 | 99.0% |
| 147 | KP294521 | Vassobia dichotoma chloroplast, complete genome | 952 | 99.7% | 923.0 | 0.00e+00 | 99.0% |
| 148 | MZ221921 | Solanum medians voucher E:Gonzales et al. 9 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 149 | MH021451 | Solanum canasense plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 150 | ON509847 | Solanum x curtilobum voucher PI 604207 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 151 | NC_086548 | Solanum morelliforme voucher CIP 764271 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 152 | NC_062863 | Jaltomata sinuosa chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 153 | OM638073 | Solanum bulbocastanum chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 154 | MH021410 | Solanum andreanum plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 155 | ON509711 | Solanum berthaultii voucher CIP 760257 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 156 | MH021545 | Solanum phureja plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 157 | NC_041607 | Solanum stenotomum voucher PI 320364 plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 158 | OM638079 | Solanum tuberosum chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 159 | NC_086524 | Solanum wittmackii voucher CIP 762077 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 160 | ON509750 | Solanum medians voucher CIP 761503 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 161 | NC_062870 | Solanum boliviense voucher CORD:Barboza et al. 3562 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 162 | NC_041603 | Solanum chomatophilum voucher PI 365328 plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 163 | OR632701 | Solanum tuberosum chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 164 | NC_041620 | Solanum multiinterruptum voucher PI 210044 plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 165 | ON509811 | Solanum albornozii voucher CIP 763735 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 166 | MH021401 | Solanum acroglossum plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 167 | MH021510 | Solanum marinasense plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 168 | NC_041625 | Solanum phureja voucher PI 195191 plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 169 | MH021530 | Solanum multiinterruptum plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 170 | MH021431 | Solanum bukasovii plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 171 | OM638058 | Solanum cajamarquense chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 172 | MH021434 | Solanum bukasovii plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 173 | MT120860 | Solanum bukasovii isolate BUK1 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 174 | NC_041621 | Solanum bukasovii f. multidissectum voucher PI 210052 plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 175 | MK690622 | Solanum cardiophyllum chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 176 | MH021432 | Solanum bukasovii plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 177 | ON509782 | Solanum multiinterruptum voucher CIP 762407 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 178 | MH021449 | Solanum canasense plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 179 | NC_041590 | Solanum albornozii voucher PI 498206 plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 180 | NC_041591 | Solanum ambosinum voucher PI 365317 plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 181 | MH021518 | Solanum megistacrolobum plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 182 | ON509767 | Solanum chomatophilum voucher CIP 762055 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 183 | OM638069 | Solanum raphanifolium chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 184 | MH021437 | Solanum bukasovii plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 185 | ON509766 | Solanum chiquidenum voucher CIP 762052 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 186 | NC_069602 | Solanum piurae chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 187 | NC_041613 | Solanum jamesii voucher PI 641944 plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 188 | OM302453 | Solanum candolleanum voucher SC4-1 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 189 | ON509807 | Solanum candolleanum voucher CIP 763651 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 190 | OM638067 | Solanum paucissectum chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 191 | NC_041588 | Solanum acroglossum voucher PI 365313 plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 192 | NC_069604 | Solanum tarnii x Solanum tuberosum chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 193 | OM638055 | Solanum bukasovii chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 194 | NC_050208 | Solanum x juzepczukii isolate JUZ chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 195 | PP234974 | Solanum aculeatissimum voucher LXP-13-07963 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 196 | ON509697 | Solanum tuberosum voucher CIP 703514 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 197 | MH021448 | Solanum canasense plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 198 | ON509795 | Solanum chomatophilum voucher CIP 762615 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 199 | NC_086545 | Solanum trifidum voucher CIP 764145 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 200 | NC_041599 | Solanum cajamarquense voucher PI 230522 plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 201 | NC_050207 | Solanum tuberosum subsp. andigenum isolate ADG1 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 202 | ON509824 | Solanum morelliforme voucher CIP 764293 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 203 | MH021566 | Solanum stenotomum plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 204 | ON509775 | Solanum medians voucher CIP 762256 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 205 | NC_041626 | Solanum pinnatisectum voucher PI 253214 plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 206 | OR360844 | Schraderanthus viscosus chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 207 | MH021519 | Solanum megistacrolobum plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 208 | MH021438 | Solanum bulbocastanum plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 209 | NC_041617 | Solanum limbaniense voucher PI 473468 plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 210 | OM638066 | Solanum megistacrolobum chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 211 | ON509754 | Solanum lignicaule voucher CIP 761652 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 212 | ON509751 | Solanum candolleanum voucher CIP 761510 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 213 | ON509685 | Solanum tuberosum voucher CIP 703308 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 214 | MH021435 | Solanum bukasovii plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 215 | ON509763 | Solanum bulbocastanum voucher CIP 761933 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 216 | ON509691 | Solanum tuberosum voucher CIP 703433 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 217 | MH021506 | Solanum leptophyes plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 218 | ON509757 | Solanum candolleanum voucher CIP 761739 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 219 | MH021447 | Solanum canasense plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 220 | ON509768 | Solanum candolleanum voucher CIP 762068 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 221 | NC_069597 | Solanum chiquidenum chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 222 | NC_086550 | Solanum ehrenbergii voucher PI 275216 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 223 | XM_059432982 | PREDICTED: Lycium ferocissimum ribulose bisphosphate carboxylase large chain (LOC132042439), mRNA | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 224 | ON509791 | Solanum cajamarquense voucher CIP 762608 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 225 | KT178121 | Physalis virginiana voucher Aust 157 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; plastid | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 226 | MH021433 | Solanum bukasovii plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 227 | ON509770 | Solanum wittmackii voucher CIP 762093 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 228 | NC_041596 | Solanum stenophyllidium voucher PI 320265 plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 229 | ON509792 | Solanum chomatophilum voucher CIP 762611 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 230 | ON509779 | Solanum acaule voucher CIP 762345 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 231 | ON509790 | Solanum chomatophilum voucher CIP 762576 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 232 | OM638050 | Solanum acaule chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 233 | NC_041587 | Solanum achacachense voucher PI 558032 plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 234 | OP056022 | Solanum tuberosum chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 235 | OM638070 | Solanum raphanifolium chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 236 | ON509724 | Solanum medians voucher CIP 760415 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 237 | ON509759 | Solanum candolleanum voucher CIP 761827 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 238 | NC_041595 | Solanum x blanco-galdosii voucher PI 498214 plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 239 | KX086697 | Solanum habrochaites isolate TGRC LA2196 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 240 | NC_041619 | Solanum megistacrolobum voucher PI 210034 plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 241 | MH021408 | Solanum ambosinum plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 242 | MT120867 | Solanum bukasovii isolate BUK2 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 243 | NC_068253 | Solanum raphanifolium voucher SR1 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 244 | NC_041610 | Solanum marinasense voucher PI 498255 plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 245 | ON509802 | Solanum stipuloideum voucher CIP 763111 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 246 | ON509720 | Solanum candolleanum voucher CIP 760337 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 247 | MH021526 | Solanum multiinterruptum plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 248 | NC_062506 | Solanum candolleanum voucher BM:Knapp et al. 10251 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 249 | MH021442 | Solanum canasense plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 250 | MH021443 | Solanum canasense plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 251 | ON509849 | Solanum tuberosum voucher PI 607886 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 252 | ON509704 | Solanum chomatophilum voucher CIP 760056 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 253 | ON509774 | Solanum medians voucher CIP 762218 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 254 | MH021446 | Solanum canasense plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 255 | MH021570 | Solanum stenotomum plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 256 | NC_041611 | Solanum hypacrarthrum voucher PI 473477 plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 257 | MH021543 | Solanum phureja plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 258 | MT120862 | Solanum tuberosum subsp. andigenum isolate ADG2 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 259 | NC_041551 | Solanum acaule chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 260 | OM638082 | Solanum tacnaense chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 261 | ON509844 | Solanum x juzepczukii voucher PI 599259 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 262 | OR360845 | Oryctes nevadensis chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 263 | XM_059436179 | PREDICTED: Lycium ferocissimum ribulose bisphosphate carboxylase large chain (LOC132045594), mRNA | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 264 | MH021404 | Solanum ambosinum plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 265 | NC_086521 | Solanum huancabambense voucher CIP 760955 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 266 | ON509839 | Solanum tuberosum voucher PI 546023 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 267 | NC_041586 | Solanum abancayense voucher PI 458403 plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 268 | MH021541 | Solanum phureja plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 269 | NC_026879 | Solanum habrochaites isolate TS-407 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 270 | ON509771 | Solanum multiinterruptum voucher CIP 762103 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 271 | OQ473543 | Solanum habrochaites chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 272 | OM638052 | Solanum acaule chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 273 | NC_026906 | Dunalia brachyacantha chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 274 | MZ233590 | Solanum pinnatisectum voucher SP-10 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 275 | NC_061388 | Solanum aculeatissimum chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 276 | MH021493 | Solanum jamesii plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 277 | MH021539 | Solanum phureja plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 278 | MH021527 | Solanum multiinterruptum plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 279 | ON509752 | Solanum chomatophilum voucher CIP 761551 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 280 | ON509834 | Solanum jamesii voucher PI 458424 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 281 | ON509740 | Solanum chiquidenum voucher CIP 761069 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 282 | NC_062469 | Solanum trisectum voucher HFN:974750147 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 283 | ON509793 | Solanum chomatophilum voucher CIP 762613 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 284 | ON509760 | Solanum candolleanum voucher CIP 761843 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 285 | OM638051 | Solanum acaule chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 286 | NC_062502 | Solanum humectophilum voucher E:Sarkinen et al. 4625 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 287 | ON509749 | Solanum multiinterruptum voucher CIP 761424 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 288 | MG946936 | Withania frutescens ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit gene, partial cds; chloroplast | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 289 | NC_069607 | Solanum tarapatanum chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 290 | NC_041598 | Solanum bukasovii voucher PI 266385 plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 291 | ON509713 | Solanum boliviense voucher CIP 760279 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 292 | ON509755 | Solanum raphanifolium voucher CIP 761655 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 293 | ON509829 | Solanum raphanifolium voucher PI 296126 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 294 | ON509748 | Solanum boliviense voucher CIP 761384 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 295 | MH021547 | Solanum pinnatisectum plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 296 | NC_041600 | Solanum canasense voucher PI 210035 plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 297 | MH021525 | Solanum multiinterruptum plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 298 | ON509781 | Solanum raphanifolium voucher CIP 762358 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 299 | NC_007943 | Solanum bulbocastanum chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 300 | MH021520 | Solanum megistacrolobum plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 301 | ON509741 | Solanum piurae voucher CIP 761072 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 302 | NC_050205 | Solanum ahanhuiri isolate AJH chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 303 | NC_086525 | Solanum augustii voucher CIP 762633 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 304 | ON509794 | Solanum chomatophilum voucher CIP 762614 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 305 | MN866909 | Lycium ferocissimum chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 306 | ON509843 | Solanum x juzepczukii voucher PI 595438 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 307 | MH021406 | Solanum ambosinum plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 308 | ON509764 | Solanum candolleanum voucher CIP 762001 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 309 | ON509705 | Solanum chomatophilum voucher CIP 760057 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 310 | MH021411 | Solanum andreanum plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 311 | NC_069599 | Solanum gracilifrons chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 312 | NC_041592 | Solanum andreanum voucher PI 320345 plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 313 | OQ473541 | Solanum peruvianum chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 314 | NC_069600 | Solanum infundibuliforme chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 315 | ON509805 | Solanum multiinterruptum voucher CIP 763491 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 316 | ON509700 | Solanum ahanhuiri voucher CIP 706209 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 317 | MH021569 | Solanum stenophyllidium plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 318 | OM638075 | Solanum pinnatisectum chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 319 | ON509722 | Solanum raphanifolium voucher CIP 760351 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 320 | MH021461 | Solanum chomatophilum plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 321 | NC_041589 | Solanum acroscopicum voucher PI 365314 plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 322 | MT984233 | Solanum habrochaites chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 323 | MH021567 | Solanum stenotomum plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 324 | MH021407 | Solanum ambosinum plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 325 | ON509756 | Solanum raphanifolium voucher CIP 761683 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 326 | MH021421 | Solanum stenophyllidium plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 327 | MH021505 | Solanum leptophyes plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 328 | NC_069606 | Solanum tacnaense chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 329 | NC_086526 | Solanum dolichocremastrum voucher CIP 762998 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 330 | MK690624 | Solanum jamesii chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 331 | ON509690 | Solanum tuberosum voucher CIP 703421 chloroplast, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 332 | MH021524 | Solanum bukasovii f. multidissectum plastid, complete genome | 955 | 100.0% | 923.0 | 0.00e+00 | 98.8% |
| 333 | AM235152 | Lycium ferocissimum chloroplast partial rbcL gene for ribulose bisphosphate carboxylase large subunit, specimen voucher Balele K. 5 (NBG) | 954 | 99.9% | 922.0 | 0.00e+00 | 98.8% |
| 334 | OP028208 | Physalis peruviana chloroplast, complete genome | 952 | 99.7% | 920.0 | 0.00e+00 | 98.8% |
| 335 | NC_026570 | Physalis peruviana plastid, complete genome | 952 | 99.7% | 920.0 | 0.00e+00 | 98.8% |
| 336 | NC_062488 | Solanum pachyandrum voucher BM:Sarkinen et al. 4546 chloroplast, complete genome | 952 | 99.7% | 920.0 | 0.00e+00 | 98.8% |
| 337 | KY887588 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 338 | OQ473547 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 339 | MH021549 | Solanum polyadenium plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 340 | NC_070364 | Physalis philadelphica chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 341 | KX086688 | Solanum ochranthum isolate TGRC LA2161 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 342 | OQ473536 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 343 | MH021473 | Solanum gourlayi plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 344 | AB586586 | Nicotiana sp. SH-2010 chloroplast gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds, isolate: T077 | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 345 | NC_072167 | Physalis cordata chloroplast, complete sequence | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 346 | NC_041618 | Solanum medians voucher PI 210045 plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 347 | LC613092 | Solanum lycopersicum CMS[P] chloroplast DNA, contig: CMS-PCp054, partial sequence | 955 | 100.0% | 1840.0 | 0.00e+00 | 98.7% |
| 348 | ON509733 | Solanum polyadenium voucher CIP 760726 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 349 | NC_026882 | Solanum pimpinellifolium isolate TS-415 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 350 | ON203960 | Solanum capsicoides chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 351 | MH021554 | Solanum sparsipilum plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 352 | OQ473538 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 353 | ON509717 | Solanum brevicaule voucher CIP 760324 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 354 | NC_062481 | Solanum salicifolium voucher HFN:s.n. chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 355 | NC_041628 | Solanum sogarandinum voucher PI 230510 plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 356 | MH021523 | Solanum bukasovii f. multidissectum plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 357 | KX086703 | Solanum lycopersicum ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 358 | KX086693 | Solanum lycopersicum isolate TGRC LA1320 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 359 | AC239738 | Solanum lycopersicum strain Heinz 1706 chromosome 1 clone hba-240p19 map 1, complete sequence | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 360 | MT811791 | Solanum lycopersicum cultivar PDS chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 361 | OQ473542 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 362 | OQ473549 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 363 | ON509718 | Solanum brevicaule voucher CIP 760327 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 364 | NC_062511 | Solanum cantense voucher BM:Sarkinen et al. 4079 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 365 | OQ473532 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 366 | LC613093 | Solanum lycopersicum CMS[P] chloroplast DNA, contig: CMS-PCp055, partial sequence | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 367 | NC_062489 | Solanum paposanum voucher BM:Sarkinen et al. 4091 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 368 | NC_062871 | Solanum brachyantherum voucher E:Baines et al. 56 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 369 | OR166175 | Withania somnifera chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 370 | MH021514 | Solanum medians plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 371 | ON509806 | Solanum candolleanum voucher CIP 763648 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 372 | NC_041629 | Solanum sparsipilum voucher PI 246536 plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 373 | OQ473534 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 374 | MH021488 | Solanum incamayoense plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 375 | MH019242 | Physalis peruviana chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 376 | MT811790 | Solanum lycopersicum cultivar Corbarino chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 377 | MH021516 | Solanum medians plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 378 | MH021428 | Solanum brevicaule plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 379 | MZ221859 | Solanum salicifolium voucher BM:Knapp 10492 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 380 | MH021478 | Solanum gourlayi plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 381 | ON509723 | Solanum lignicaule voucher CIP 760353 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 382 | MH021491 | Solanum incamayoense plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 383 | LC613099 | Solanum lycopersicum O chloroplast DNA, contig: OCp002, partial sequence | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 384 | NC_062471 | Solanum tweedianum voucher CORD:Barboza 2229 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 385 | OQ473545 | Solanum pimpinellifolium chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 386 | OQ473527 | Solanum pimpinellifolium chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 387 | KP331414 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 388 | MH021489 | Solanum incamayoense plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 389 | ON509761 | Solanum bulbocastanum voucher CIP 761896 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 390 | ON509708 | Solanum brevicaule voucher CIP 760235 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 391 | NC_041601 | Solanum cardiophyllum voucher PI 283062 plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 392 | MH021553 | Solanum sparsipilum plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 393 | OQ473533 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 394 | OQ473526 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 395 | MH021471 | Solanum gourlayi plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 396 | MG946905 | Withania somnifera ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit gene, partial cds; chloroplast | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 397 | OQ473537 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 398 | NC_085278 | Physalis ixocarpa chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 399 | KX086702 | Solanum lycopersicum isolate UIB 1-30 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 400 | LC613090 | Solanum lycopersicum CMS[MSA1] chloroplast DNA, contig: CMS-MSA1Cp001, partial sequence | 955 | 100.0% | 1840.0 | 0.00e+00 | 98.7% |
| 401 | NC_041624 | Solanum paucissectum voucher PI 473489 plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 402 | MT973500 | Solanum pimpinellifolium chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 403 | MG946897 | Solanum virginianum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit gene, partial cds; chloroplast | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 404 | OQ473529 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 405 | MH021513 | Solanum medians plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 406 | OQ473539 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 407 | OQ473521 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 408 | NC_062873 | Solanum annuum voucher CORD:Barboza 3017 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 409 | MH021444 | Solanum canasense plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 410 | NC_086547 | Solanum lesteri voucher CIP 764266 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 411 | MH021427 | Solanum brevicaule plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 412 | NC_062480 | Solanum salamancae voucher CORD:Barboza 2182 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 413 | U08618 | Salpiglossis sinuata chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 414 | MN192191 | Physalis philadelphica cultivar Wild chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 415 | KX086701 | Solanum lycopersicum isolate UIB 1-48 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 416 | NC_062508 | Solanum capsicoides voucher E:Sarkinen et al. 4547 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 417 | ON509826 | Solanum medians voucher PI 265872 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 418 | NC_007898 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 419 | NC_062862 | Jaltomata bicolor voucher E:Gonzales 2880 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 420 | MH021529 | Solanum bukasovii f. multidissectum plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 421 | LC613091 | Solanum lycopersicum CMS[O] chloroplast DNA, contig: CMS-OCp001, partial sequence | 955 | 100.0% | 1840.0 | 0.00e+00 | 98.7% |
| 422 | MH021454 | Solanum cardiophyllum plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 423 | PP471919 | Physalis minima isolate R2 plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 424 | NC_039458 | Physalis pruinosa chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 425 | ON509747 | Solanum lignicaule voucher CIP 761212 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 426 | HG975525 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 427 | ON509836 | Solanum brevicaule voucher PI 473065 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 428 | OQ473530 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 429 | OM638077 | Solanum sparsipilum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 430 | NC_062477 | Solanum remyanum voucher E:Baines et al. 115 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 431 | ON509830 | Solanum infundibuliforme voucher PI 458324 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 432 | LC613098 | Solanum lycopersicum O chloroplast DNA, contig: OCp001, partial sequence | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 433 | NC_041627 | Solanum polyadenium voucher PI 161728 plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 434 | LC613095 | Solanum pimpinellifolium LA1670 chloroplast DNA, contig: LA1670Cp001, partial sequence | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 435 | KX086699 | Solanum galapagense isolate TGRC LA0930 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 436 | MH021490 | Solanum incamayoense plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 437 | OR166174 | Withania somnifera chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 438 | ON509719 | Solanum brevicaule voucher CIP 760328 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 439 | ON509706 | Solanum brevicaule voucher CIP 760230 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 440 | MT811792 | Solanum lycopersicum cultivar Piennolo giallo chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 441 | OQ473524 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 442 | ON509762 | Solanum bulbocastanum voucher CIP 761898 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 443 | NC_026878 | Solanum galapagense isolate TS-208 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 444 | KY887587 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 445 | OQ473522 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 446 | OQ473528 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 447 | ON509772 | Solanum cantense voucher CIP 762130 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 448 | NC_041616 | Solanum leptophyes voucher PI 458378 plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 449 | LC613103 | Solanum lycopersicum Sekai-ichi chloroplast DNA, contig: Sekai-ichiCp001, partial sequence | 955 | 100.0% | 1840.0 | 0.00e+00 | 98.7% |
| 450 | MH021511 | Solanum marinasense plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 451 | NC_062421 | Solanum aureum voucher E:Balls 5826 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 452 | MH021470 | Solanum gourlayi plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 453 | OQ473546 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 454 | MH021436 | Solanum bukasovii plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 455 | ON509799 | Solanum mochiquense voucher CIP 762989 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 456 | MH021504 | Solanum leptophyes plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 457 | ON509701 | Solanum paucissectum voucher CIP 760007 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 458 | NC_062718 | Solanum mochiquense voucher SM1-3 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 459 | OR296714 | Physalis ampla chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 460 | MH045574 | Physalis angulata chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 461 | JF772171 | Solanum tuberosum isolate RH89-039-16 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 462 | AB586587 | Physalis sp. SH-2010 chloroplast gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds, isolate: T964 | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 463 | KX086692 | Solanum pimpinellifolium isolate TGRC LA0114 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 464 | NC_026876 | Solanum cheesmaniae isolate TS-199 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 465 | KP117024 | Solanum lycopersicum isolate TS-321 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 466 | OP748222 | Physalis longifolia var. subglabrata chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 467 | OQ473548 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 468 | MH021424 | Solanum brevicaule plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 469 | MH021507 | Solanum leptophyes plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 470 | MT811798 | Solanum pimpinellifolium chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 471 | LC613100 | Solanum lycopersicum P chloroplast DNA, contig: PCp001, partial sequence | 955 | 100.0% | 1840.0 | 0.00e+00 | 98.7% |
| 472 | OQ473531 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 473 | NC_081500 | Brugmansia arborea chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 474 | MH021555 | Solanum sparsipilum plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 475 | OQ473525 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 476 | NC_069601 | Solanum lignicaule chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 477 | NC_041606 | Solanum gourlayi voucher PI 472911 plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 478 | MH021426 | Solanum brevicaule plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 479 | AM087200 | Solanum lycopersicum complete chloroplast genome, cultivar IPA-6 | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 480 | OQ473535 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 481 | OM257167 | Physalis angulata var. villosa chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 482 | MH021423 | Solanum brevicaule plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 483 | MH021469 | Solanum gourlayi plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 484 | MH021439 | Solanum bulbocastanum plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 485 | MH021425 | Solanum brevicaule plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 486 | NC_041612 | Solanum incamayoense voucher PI 473060 plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 487 | MH021468 | Solanum gourlayi plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 488 | NC_062482 | Solanum sanchez-vegae voucher E:Gonzales 2389 chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 489 | OQ473523 | Solanum lycopersicum chloroplast, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 490 | MH021590 | Solanum microdontum plastid, complete genome | 955 | 100.0% | 920.0 | 0.00e+00 | 98.7% |
| 491 | KC535803 | Solanum nigrum isolate SN03 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 953 | 99.8% | 918.0 | 0.00e+00 | 98.7% |
| 492 | NC_039415 | Solanum usambarense voucher BM:Vorontsova et al. 166 chloroplast, complete genome | 952 | 99.7% | 917.0 | 0.00e+00 | 98.7% |
| 493 | NC_039608 | Solanum aethiopicum voucher BM:Vorontsova et al. 156 chloroplast, complete genome | 952 | 99.7% | 917.0 | 0.00e+00 | 98.7% |
| 494 | MN218076 | Solanum aethiopicum cultivar Yiliuliu isolate NN1 chloroplast, complete genome | 952 | 99.7% | 917.0 | 0.00e+00 | 98.7% |
| 495 | NC_039457 | Physalis angulata chloroplast, complete genome | 955 | 100.0% | 919.0 | 0.00e+00 | 98.6% |
| 496 | L14403 | Lycopersicon esculentum chloroplast ribulosebisphosphate carboxylase large subunit (rbcL) gene, partial cds | 955 | 100.0% | 919.0 | 0.00e+00 | 98.6% |
| 497 | MH360739 | Solanum nigrum ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 955 | 100.0% | 917.0 | 0.00e+00 | 98.6% |
| 498 | NC_062472 | Solanum umalilaense voucher HFN:A14750133 chloroplast, complete genome | 955 | 100.0% | 917.0 | 0.00e+00 | 98.6% |
| 499 | LC613096 | Solanum lycopersicum var. cerasiforme LA1673 chloroplast DNA, contig: LA1673Cp001, partial sequence | 955 | 100.0% | 1828.0 | 0.00e+00 | 98.5% |
| 500 | LC613102 | Solanum acaule chloroplast DNA, contig: SacauleCp001, partial sequence | 955 | 100.0% | 1758.0 | 0.00e+00 | 97.3% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
The boxplot above shows the identity (%) of BLAST hits grouped by genus. Each data point shows the alignment identity between the query and matched reference sequence. The analyst may wish to use this to make a subjective genus-level identification for the sample.
This sections shows the taxa of interest specified by the submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
| Taxon of interest | Match rank | Match taxon | Match species | Match accession | Match identity |
|---|---|---|---|---|---|
| Nicotiana tabacum | species | Nicotiana tabacum | Nicotiana tabacum | AP019624 | 0.997 |
See the Database coverage section to see database coverage for taxa of interest.
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
No candidate species to report on.
The target taxa include candidate species, the preliminary morphology ID, and any taxa of interest provided by the submitter. Each of these taxa are independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of the target taxon. Insufficient coverage of a taxon can result in that taxon not be correctly identified as the taxonomic identity of the sample. For example, if the sample is Homo sapiens, but Homo sapiens sequences are not included in the reference database, the analysis will be unable to identity Homo sapiens as the correct taxonomic identity, and will most likely assign the closest relative with reference data as the taxonomic identity.
Preliminary ID
Taxa of interest
Database coverage
Flag 5.1C:
The reference database is likely to be unreliable for this species
Reasoning: The given locus for this taxon is not present in reference database (0 entries)
Flag 5.1C:
The reference database is likely to be unreliable for this species
Reasoning: The given locus for this taxon is not present in reference database (0 entries)
There are 0 sequences in the reference database for Planta at the given locus rbcL.
Global occurrence records for Planta.
Note that the occurrence data are not exhaustive, and it is possible for this species to occur in regions not shown on the map.
Flag 5.2C:
The database has poor support for species in this genus
Reasoning: ≤10% of taxon have reference sequence(s) at the given locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus rbcL
Flag 5.3C:
Probability that a different related species from the country of origin is the true taxonomic identity: LOW
Reasoning: No species in genus have been observed in the country of origin
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus rbcL
Database coverage
Flag 5.2B:
The database has some support for species in this genus
Reasoning: 10-90% of related taxa have reference sequence(s) at the given locus
Flag 5.1A:
The reference data supports this taxon well
Reasoning: The given locus for this taxon is well represented in reference database (>5 entries)
There are 28 sequences in the reference database for Nicotiana tabacum at the given locus rbcL.
Global occurrence records for Nicotiana tabacum.
Note that the occurrence data are not exhaustive, and it is possible for this species to occur in regions not shown on the map.
Flag 5.2B:
The database has some support for species in this genus
Reasoning: 10-90% of related taxa have reference sequence(s) at the given locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus rbcL
Flag 5.3A:
Probability that a different related species from the country of origin is the true taxonomic identity: LOW
Reasoning: All species in genus from country of origin have reference sequence(s) for this locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus rbcL
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |